Reading your first FASTQ file without fear

FASTQ is the format that comes off a sequencer, and the first time you open one it looks like line noise. But it follows a simple, rigid pattern — once you see it, you can never un-see it.

The four lines

Every read in a FASTQ file is exactly four lines, and they always mean the same thing:

• Line 1 — an identifier, always starting with @
• Line 2 — the actual DNA sequence (A, C, G, T, N)
• Line 3 — a separator, always a + (sometimes repeating the id)
• Line 4 — quality scores, one character per base

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCC
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**

Reading the quality line

That last line looks like someone fell on the keyboard, but each character encodes how confident the sequencer was in that base, using ASCII. A '!' is the lowest quality; letters and symbols further along the table are better. Tools like FastQC read these for you — but now you know what they're actually looking at.

That's the whole format. Four lines, repeated millions of times. Everything in NGS analysis starts here.